6.
Which of the following statements is FALSE?
A DNA, chromosomes, and genes work together t...
6.
Which of the following statements is FALSE?
A DNA, chromosomes, and genes work together to determine heredity in organisms.
B Genes are found in chromosomes but not DNA.
C Differences between organisms are due to specific alterations in the nucleotide
sequences
D Chromosomes and genes allow the information encoded on the DNA strand to be
copied and transferred.
Answers: 2
Biology, 22.06.2019 01:30
Plz ! cattle ranchers and dairy farmers rarely allow all of their animals to reproduce instead they practice selective breeding and only encourage the reproduction of animals with specific features. which of the following cows would a dairy farm most likely choose to reproduce? a. a cow that makes a lot of milk. b. a cow that can run quickly. c. a cow with a think, soft fur. d. a cow with large, strong hooves.
Answers: 1
Biology, 22.06.2019 07:00
What molecules will be best used to compare different species with the exact same sequence of amino acids? why would two species have the same protein even if the molecules in question is different? (hint: transcription to translation to protein).
Answers: 1
Biology, 22.06.2019 08:00
Reactants undergo chemical reaction to form products. this chemical equation represents one such reaction. the coefficient for one of the reactants or products is incorrect. which part of the chemical equation is incorrect?
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Mathematics, 02.02.2020 16:53
History, 02.02.2020 16:53
Mathematics, 02.02.2020 16:53
Physics, 02.02.2020 16:53
Geography, 02.02.2020 16:54
Social Studies, 02.02.2020 16:54
Mathematics, 02.02.2020 16:54
Mathematics, 02.02.2020 16:54
Biology, 02.02.2020 16:54
Mathematics, 02.02.2020 16:54
Mathematics, 02.02.2020 16:54
Mathematics, 02.02.2020 16:54