![subject](/tpl/images/cats/biologiya.png)
The solute potential can be calculated by Ys = - iCRT, where i is the ionization constant,
C is the molar concentration, R is the pressure constant (0.00831 liter bars/(mole ok))
and T is the temperature in OK. Calculate the solute potential of a 2.0 M sucrose solution
at 20°C under standard atmospheric condition. Take into account that sucrose doesn't
ionize in water, so its ionization constant (i) is 1.
a) -3.32 bars
b) -4.87 bars
c) -45.37 bars
d) -5.48 bars
![ansver](/tpl/images/cats/User.png)
Answers: 3
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 07:00
Give an example of a trait that is controlled by more than one gene.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:30
In meiosis ii during anaphase ii which structures separated homologous chromosomes or sister chromatids
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:20
Where is the nictitating membrane found? a. between the eyelid and the eyeball b. between the retina and the optic nerve c. between the outer and middle ear d. in the organ of corti in the middle ear
Answers: 2
You know the right answer?
The solute potential can be calculated by Ys = - iCRT, where i is the ionization constant,
C is the...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 31.08.2020 22:01
![question](/tpl/images/cats/mat.png)
Mathematics, 31.08.2020 22:01
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/istoriya.png)
History, 31.08.2020 22:01
![question](/tpl/images/cats/istoriya.png)
History, 31.08.2020 22:01
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/en.png)
English, 31.08.2020 22:01
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/health.png)
Health, 31.08.2020 22:01
![question](/tpl/images/cats/mat.png)
Mathematics, 31.08.2020 22:01
![question](/tpl/images/cats/mat.png)
Mathematics, 31.08.2020 22:01
![question](/tpl/images/cats/mkx.png)
Arts, 31.08.2020 22:01
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mkx.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 31.08.2020 22:01
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 31.08.2020 22:01