subject
Biology, 27.01.2021 14:00 randall10

Identifying the Different Levels of Organization Complete the sentences to describe the different levels of organization in organisms.
A(n)
is a group of organs that work together to perform a common function.
A(n)
is a group of tissues that work together to perform a common function.
A(n) is a basic unit of structure and function of all living things.
A(n)
vis a group of cells that work together to perform a common function.

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 21:50
What is a gene ? a) a section of a protein that codes for dna. b) the alternate version of a trait. c) the visible trait in the f1 generation. d) a section of dna that codes for a specific trait .
Answers: 1
question
Biology, 22.06.2019 08:10
Match the functions to the cell types ? contraction and relaxation. conducting electrochemical signals fighting diseases carrying genetic material
Answers: 1
question
Biology, 22.06.2019 09:00
Recommend a strategy for incorporating sustainable human activity into a tropical rain forest biome.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Identifying the Different Levels of Organization Complete the sentences to describe the different l...
Questions
question
Mathematics, 25.04.2021 01:00
question
Mathematics, 25.04.2021 01:00
question
Mathematics, 25.04.2021 01:00
question
Mathematics, 25.04.2021 01:00
question
Mathematics, 25.04.2021 01:00
question
Mathematics, 25.04.2021 01:00