![subject](/tpl/images/cats/biologiya.png)
Biology, 25.01.2021 22:10 javonteoshamccaliste
Replicate the following sequence: GTACGTTTACGTACTG
![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 05:30
The vaccine in a flu shot contains weakened flu viruses. how does a flu shot work with the immune system? a. it destroys lymphocytes. b. it destroys macrophages. c. it activates macrophages. d. it activates lymphocytes.
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:00
Which of these transport mechanisms moves glucose from the blood into a cell? active transport diffusion facilitated diffusion osmosis
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:00
When a gasoline engine burns gasoline, what type of chemical reaction is occurring?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Replicate the following sequence: GTACGTTTACGTACTG...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 23.06.2019 23:10
![question](/tpl/images/cats/mat.png)
Mathematics, 23.06.2019 23:10
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 23.06.2019 23:10
![question](/tpl/images/cats/mat.png)
Mathematics, 23.06.2019 23:10
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/istoriya.png)
History, 23.06.2019 23:10
![question](/tpl/images/cats/himiya.png)
Chemistry, 23.06.2019 23:10
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/fizika.png)