subject
Biology, 25.01.2021 20:40 krystalhurst97

Identical, or monozygotic, twins develop from a single egg fertilized by a single sperm. Monozygotic twins are genetically identical because they originate from a single zygote that split into two. Caroline Lost and her colleagues examined nine measures of social, behavioral, and cognitive ability in 1000 pairs of both male and female identical twins. Their study found that pairs of male twins tended to be more alike in their prosocial behavior, peer problems, and verbal ability scores than pairs of female twins. Which statement explains this observation?

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 19:30
What would be the most likely result if the ph of the stomach were increased to 5
Answers: 1
question
Biology, 22.06.2019 02:20
Astudent analyzed ears of corn that demonstrated two traits in the f2 kernels, purple or white colors and smooth on wrinkled shapes. a tabulation of 135 individual kernels gave the following results: purple and smooth = 75 white and smooth = 28 purple and wrinkled = 24 white and wrinkled = 8 what would be the only phenotype present in the f1 ger
Answers: 3
question
Biology, 22.06.2019 11:00
Use the above pedigree for questions 1,2, and 3 1. what kind of genetic disorder is represented in the pedigree? a. recessive b. dominate refer to the pedigree in question 1. 2. is the mutated gene in this disorder located on a sex chromosome (x or y) or an autosome? a. sex chromosome b. autosome refer to the pedigree in question 1. 3. which generation has individuals that you are certain are heterozygous for the mutated gene? a. generation 1 b. generation 2 c. generation 3
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Identical, or monozygotic, twins develop from a single egg fertilized by a single sperm. Monozygotic...
Questions
question
Mathematics, 24.06.2019 12:00
question
Mathematics, 24.06.2019 12:00