subject
Biology, 22.01.2021 21:20 xchainq

What is the definition of hay

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 14:30
5) these are organisms where the genetic material is not bound by a nucleus. they are usually unicellular.
Answers: 1
question
Biology, 21.06.2019 23:30
The table shows dates and appearance of index fossils. which rock layers can be dated most precisely? a) a layer containing both a fossil 4 and a fossil 3 b) a layer containing both a fossil 2 and a fossil 3 c) a layer containing both a fossil 1 and a fossil 4 d) a layer containing both a fossil 1 and a fossil 2
Answers: 2
question
Biology, 22.06.2019 05:00
2. if someone had the list of traits you provided in question 1, do you think he or she would be able to find you in a group of 1000 people? why or why not? if not, what other information encoded in your genes might distinguish you from the others in the group? what are other traits that are encoded for by dna?
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What is the definition of hay...
Questions
question
Mathematics, 20.07.2019 15:30