Chromosomes determine all inherited traits because they are made up of
A. ATP
B. DNA
C....
Biology, 21.01.2021 22:40 kedjenpierrelouis
Chromosomes determine all inherited traits because they are made up of
A. ATP
B. DNA
C. centromeres
D. phospholipids
Answers: 2
Biology, 22.06.2019 01:30
As a result of wildfires, in grasslands. a) tree growth increases b) grass growth increases c) soil quality decreases d) invertebrate variety decreases
Answers: 2
Biology, 22.06.2019 06:00
Adrought killed all the plants in an agricultural farmland. gradually, due to wind and some birds for. nearby areas, new plants started sprouting l. what stage of succession was taking place in the farmland? a) competition b) nudation c) ecesis d) reaction e) migration
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:00
Which of the following is not associated with invasive species?
Answers: 1
Mathematics, 06.06.2020 02:03
Mathematics, 06.06.2020 02:03
Mathematics, 06.06.2020 02:03
Mathematics, 06.06.2020 02:03
Mathematics, 06.06.2020 02:03
Mathematics, 06.06.2020 02:03