Biology, 13.01.2021 23:30 honey66

HELPPP QUICK PLEASE A change within a single base pair in DNA is least likely to be observable if the change affects-
A. the production of a stop codon
B. an unexpressed recessive trait
C. actions of a codominant allele
D. the expression of a sex-linked trait

Answers: 3

Show answers

Another question on Biology

Biology, 21.06.2019 12:30

Two true-breeding pea plants were crossed. one parent is round, terminal, violet, constricted, while the other expresses the respective contrasting phenotypes of wrinkled, axial, white, full. the four pairs of contrasting traits are controlled by four genes, each located on a separate chromosome. in the f1 only round, axial, violet, and full were expressed. in the f2, all possible combinations of these traits were expressed in ratios consistent with mendelian inheritance. (a) what conclusion about the inheritance of the traits can be drawn based on the f1 results? (b) in the f2 results, which phenotype appeared most frequently? what mathematical expression predicts the probability of occurrence of this phenotype? (c) which f2 phenotype is expected to occur least frequently? what mathematical expression predicts this probability? (d) in the f2 generation, how often is either of the p1 phenotypes likely to occur? express your answer as a fraction (example: 3/16).

Answers: 3

Answer

Biology, 21.06.2019 19:00

Can someone me with this and tell me what’s fracking and what does it have to do with carbon, carbon dioxide, or fossil fuels?

Answers: 2

Answer

Biology, 22.06.2019 01:00

Talking listening and reacting non verbally are all part of communicating

Answers: 2

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

HELPPP QUICK PLEASE A change within a single base pair in DNA is least likely to be observable if t...

Questions