Need mRNA
AMINO ACIDS
1.AATACCGTAACCACTA
2. GCTAGTACGTGCACATTAGAA

How are cellular respiration and photosynthesis different? cellular respiration assists breathing; photosynthesis aids pigmentation. cellular respiration breaks down glucose; photosynthesis creates glucose. cellular respiration creates glucose; photosynthesis breaks down glucose. cellular respiration releases oxygen; photosynthesis releases carbon dioxide.

Compare and contrast region e in the illustration above with region d. describe the physical characteristics of each region.

Taq polymerase is an enzyme isolated from the organism thermophilus aquaticus. this organism has been found living in the hot springs of yellowstone national park. this enzyme is used to copy human dna from crime scenes. most reactions are performed at ranges similar to those of the human body; however, what considerations should be made for optimum use of this enzyme? view available hint(s)taq polymerase is an enzyme isolated from the organism thermophilus aquaticus. this organism has been found living in the hot springs of yellowstone national park. this enzyme is used to copy human dna from crime scenes. most reactions are performed at ranges similar to those of the human body; however, what considerations should be made for optimum use of this enzyme? the enzyme will not work on human dna.nothing should be altered.the ph should be decreased.the temperature should be raised.