subject
Biology, 12.01.2021 02:00 madbiebzz

What does it mean to say the genetic code is an example of homology?

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 08:20
Which is not a characteristic of bacteria? a. they are unicellular. b. they are prokaryotic. c. they are the smallest form of life on earth. d. they are multicellular.
Answers: 2
question
Biology, 22.06.2019 08:30
Gene expression is the activation of a gent that results in a question 1 options: protein dna mitochondria
Answers: 1
question
Biology, 22.06.2019 08:30
Iwanna go do something with my ideas? ?
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What does it mean to say the genetic code is an example of homology?...
Questions
question
Mathematics, 06.06.2020 05:03