Cell differentiation is critical during embryonic development. The process of cell differentiation results in the production of many types of cells, including germ, somatic, and stem cells. Cell differentiation is most directly regulated by-- A ATP
B DNA
C lipids
D sugars

Svetlana and her mother are very similar. both have blonde hair, a love of scrapbooking, blue eyes, and a thin nose. which statement  most likely  describes svetlana’s traits? svetlana inherited her love of scrapbooking from her mother, but her blue eyes come from her environment.svetlana inherited her blue eyes from her mother, but her love of scrapbooking comes from her environment.svetlana inherited her thin nose from her mother, but her blonde hair comes from her environment.svetlana inherited her blonde hair from her mother, but her thin nose comes from her environment.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Adistinctive characteristic of mammals that is not observed in other vertebrates is