subject
Biology, 27.10.2019 05:43 alesyabursevich

Were are ribosomes that synthesize proteins found?

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 03:30
Which set of characteristics best describes sedimentary rock? a) largest type of rock, made of organic matter, hardest type of rock b) often contains layers, forms near sources of water, contains fossils c) least abundant type of rock, made of other rocks, made mostly of minerals d) most abundant type in earth's crust, made of magma/lava, contains no fossils
Answers: 1
question
Biology, 22.06.2019 03:30
What organelle other than the nucleus houses dna in a eukaryotic cell?
Answers: 1
question
Biology, 22.06.2019 11:00
1. which of the following transport mechanisms utilizes energy? a. osmosis b. diffusion c. facilitated diffusion d. endocytosis
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Were are ribosomes that synthesize proteins found?...
Questions
question
Mathematics, 24.08.2019 04:00
question
Mathematics, 24.08.2019 04:00
question
Chemistry, 24.08.2019 04:00
question
Chemistry, 24.08.2019 04:00