Biology, 05.01.2021 01:00 joco8988

Please help me with this question? What are the functions of the high-energy electrons in the electron transport chain?

They make ATP from ADP.

They create ATP synthase.

They carry NADH and FADH2.

They hold water bonds.

Answers: 1

Show answers

Another question on Biology

Biology, 21.06.2019 23:30

You can tell from this karyotype that the individual is female because the karyotype has two chromosomes labeled

Answers: 1

Answer

Biology, 22.06.2019 11:00

When ash and dust begin to settle on the ground, they eventually become compacted by

Answers: 1

Answer

Biology, 22.06.2019 14:00

Compare the shapes of the bones of the human skull with the shapes of the bones of the human leg. how do the shapes differ? why are the shapes important?

Answers: 1

Answer

Biology, 22.06.2019 15:30

Injuries in the environment are a result of

Answers: 1

Answer

You know the right answer?

Please help me with this question? What are the functions of the high-energy electrons in the elect...

Questions

Biology, 06.12.2021 09:50

If you were given a cylindrical structure cut from part of a plant, how could you tell whether it was a piece of stem or a piece of root:...

English, 06.12.2021 09:50

Pre-Reading White Man's Burden 1b. Why was White Man's Burden written? 1c. Why might the White Man's Burden be an important historical d...

Biology, 06.12.2021 09:50

Any girl little stressed out of assignment after long day wanna have little fun before going to bed? So if you down?...

English, 06.12.2021 09:50

Just getting boredtell me a joke anyone herefrm following...

English, 06.12.2021 09:50

Select the closing paragraph that is more effective, satisfying readers and summarizing the main idea, 5 As we have seen, there is a gre...

Arts, 06.12.2021 09:50

Bret had always hoped to live on the seashore? What is the phrase? What type of phrase?...

English, 06.12.2021 09:50

Anyone is on-line Here??Getting s bored...

Biology, 06.12.2021 09:50

Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACGCGCTTACGTCTGATCGCT 5' Type of mutation ( 3pts):

History, 06.12.2021 09:50

GOOD AFTERNOON ALL. . ....

Mathematics, 06.12.2021 09:50

The world’s two highest dams are both in Tajikistan. The Rogun dam is 35 meters taller than the Nurek dam. Together they are 635 meters tall. Find the...

Geography, 06.12.2021 09:50

Describe the Natural topography in Northern region?...

Mathematics, 06.12.2021 09:50

N 70 5.4 4.8 P Using trig to ding angles...

World Languages, 06.12.2021 09:50

Ilang step ang kaliangan pag uuwi kana?...

Biology, 06.12.2021 09:50

Mathematics, 06.12.2021 09:50

460,451,442,... Find the 37th term. Find the 37th term....

Arts, 06.12.2021 09:50

Based on the evidence, the officer was ready to make an arrest. What is the phrase? What type of phrase is it?...

History, 06.12.2021 09:50

In what way is this woman helping in the way effort?

Physics, 06.12.2021 09:50

If a thief jumps from the third floor of a house while holding a 10 kg box on his head, the box will feel like it weighs 50 N during the fall....

English, 06.12.2021 09:50

Mathematics, 06.12.2021 09:50

What is mean by capital?don't spam dear...

More questions: Biology Another questions

Please help me with this question? What are the functions of the high-energy electrons in the electron transport chain? They make ATP from ADP. They create ATP synthase. They carry NADH and FADH2. They hold water bonds.

Answers

Another question on Biology

Please help me with this question? What are the functions of the high-energy electrons in the electron transport chain?

They make ATP from ADP.

They create ATP synthase.

They carry NADH and FADH2.

They hold water bonds.