Biology, 21.12.2020 22:20 catchonyet
Which of the following statements best describes the state of fibroblast cells after addition of the CDK inhibitor?
Answers: 3
Biology, 22.06.2019 02:10
Scenario #2 in 2001, a population of 2,500 poison dart frogs lived in the amazon rain forest. due to increased deforestation, the population dwindled to 25 frogs in 2019. new government regulations were enacted in 2022, successfully putting an end to the deforestation of the amazon rain forest. once deforestation was stopped, the poison dart frog population was able to recover. by 2050, the population reached 8,000 frogs, of that population, 20 are homozygous recessive for being spotted (ss genotype). q2- ? q- p- p2- 2pq-
Answers: 2
Biology, 22.06.2019 10:00
Which statement is true for bacteria a. bacteria have complex internal structures b. all bacteria are spiral in shape c. all bacteria cause disease in animals d. bacteria break down some foods
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 15:40
Which kind of mutation has occurred when the codon for an amino acid is changed to a stop codon? a. a silent mutation b. a missense mutation c. a frameshift mutation d. a nonsense mutation
Answers: 1
Which of the following statements best describes the state of fibroblast cells after addition of the...
Health, 27.04.2021 15:50
Mathematics, 27.04.2021 15:50
English, 27.04.2021 15:50
English, 27.04.2021 15:50
Chemistry, 27.04.2021 15:50
Computers and Technology, 27.04.2021 15:50
Mathematics, 27.04.2021 15:50
Mathematics, 27.04.2021 15:50