subject
Biology, 18.12.2020 08:10 hannahsparks7073

What type of fingerprint pattern is this? -plain whorl
-central whorl
-double whorl
-plain arch
-tented arch
-radial loop
-ulnar loop
-accidental


What type of fingerprint pattern is this?

-plain whorl
-central whorl
-double whorl
-plain arch

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 04:30
Quick asap will give brainiest ! what best describes the same pattern of tides on earth throughout the day? neap tides spring tides semidiurnal tides nocturnal tides
Answers: 1
question
Biology, 22.06.2019 05:00
What best describes the dropping height of a ball that bounces back up to a height of 45 cm
Answers: 1
question
Biology, 22.06.2019 10:30
Ras is a g-protein that is activated when a growth factor attaches to egfr. its activation results in the replacement of a gdp molecule with a gtp molecule, thus allowing a signal transduction pathway to be activated. considering the signal pathway illustrated on this page, what is one potential outcome of a mutation in the ras gene that leads to ras protein hyperactivity. be specific.
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What type of fingerprint pattern is this? -plain whorl
-central whorl
-double whorl
Questions
question
Mathematics, 27.02.2020 02:23
question
Biology, 27.02.2020 02:23