. What are examples of Climate?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

1. -define adaptation2 explain darwin's theories of descent with modification and natural selection in detail3. -explain how each of these provides evidence for evolution: a. -fossil record, including superposition and transitional fossilsb-anatomy, including homologous structuresc-biological molecules, including dna and proteins4. -explain the difference between convergent and divergent evolution.5. -define and give three examples of artificial selection6. -define and give one example of coevolution.7. -explain biodiversity and how it benefits humans.8. -explain a type of population lest affected by environmental change.

Some species of wasps are social. the queen starts a colony from scratch each spring. she builds a small nest, and lays and raises a group of female workers. the workers enlarge the nest while the queen continues to lay eggs. unfertilized eggs become males that mate with newly hatched females. all of the wasps except the newly fertilized females die by the summer. which best describes this behavior? a)it is beneficial only to the males that do not fertilize eggs. b)it is beneficial only to the female workers that are not fertilized. c)it is beneficial to each one of the individual colony members. d)it is beneficial to the whole species, but not to all of the individual members.