Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below.
AUGCCACAGGUUCAUCCGAA…
To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?
A. Calculate the frequencies of each letter.
B. Count the number of letters in the list.
C. Separate the list into three-letter "words."
D. Separate the list into two-, three- and four-letter "words."
Answers: 3
Another question on Biology
Biology, 21.06.2019 15:00
Disinfection of impression materials is usually accomplished by a. sterilization with high heat. b. spray or immersion in a chemical disinfectant. c. sterilization with steam under pressure. d. allowing the impression to sit 24 hours in water until all the organisms die.
Answers: 2
Biology, 21.06.2019 18:30
Match the type of adaptation to the correct example, structural adaptation functional adaptation behavioral adaptation example type of adaptation elephants live in herds to protect their young leaves of a rain forest plant species have a pointed tip that enables rainwater to drain off easily. camels have nostrils that they can close snakes produce venom to kill prey and defend themselves. earthworms coil when touched, as part of a defense mechanism. human skin darkens with increased exposure to sunlight.
Answers: 3
Biology, 22.06.2019 03:30
Which set of characteristics best describes sedimentary rock? a) largest type of rock, made of organic matter, hardest type of rock b) often contains layers, forms near sources of water, contains fossils c) least abundant type of rock, made of other rocks, made mostly of minerals d) most abundant type in earth's crust, made of magma/lava, contains no fossils
Answers: 1
You know the right answer?
Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a...
Questions
Mathematics, 02.04.2021 16:30
History, 02.04.2021 16:30
Physics, 02.04.2021 16:30
Mathematics, 02.04.2021 16:30
History, 02.04.2021 16:30
Mathematics, 02.04.2021 16:30
Mathematics, 02.04.2021 16:30
Social Studies, 02.04.2021 16:30
Mathematics, 02.04.2021 16:30
Mathematics, 02.04.2021 16:30
