![subject](/tpl/images/cats/biologiya.png)
Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below.
AUGCCACAGGUUCAUCCGAA…
To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?
A. Calculate the frequencies of each letter.
B. Count the number of letters in the list.
C. Separate the list into three-letter "words."
D. Separate the list into two-, three- and four-letter "words."
![ansver](/tpl/images/cats/User.png)
Answers: 3
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 16:20
The use of dna as evidence in criminal investigations became possible because of the
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 21:00
What two fields of study provide the core information that is used to classify organisms?
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 15:30
What property of water provides for appropriate sugar, salt, and amino acid levels to be present and carried in the blood of animals to be delivered to cells
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 23:00
Which individual would be the safest from a lightening strike? a. a person standing 8 miles away b. a person on a bike 8 miles away c. a person in a tent 8 miles away d. a person in a house 8 miles away select the best answer from the choices provided a b c d
Answers: 1
You know the right answer?
Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a...
Questions
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 20.07.2019 13:10
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/istoriya.png)
History, 20.07.2019 13:10
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/ekonomika.png)
Business, 20.07.2019 13:10
![question](/tpl/images/cats/istoriya.png)
History, 20.07.2019 13:10
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/istoriya.png)
History, 20.07.2019 13:10
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 20.07.2019 13:10
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 20.07.2019 13:10
![question](/tpl/images/cats/biologiya.png)
Biology, 20.07.2019 13:10
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 20.07.2019 13:10