You are in a laboratory attempting to identify a genetic defect responsible for a disease. You believe you have located the gene that results in a faulty protein—but you aren't sure! How could you be sure you have located a section of DNA that encodes for a protein?

Write down the sequence to see what amino acids might be linked together.

Allow the DNA to be transcribed to RNA and see what protein results.

Compare the faulty protein to the DNA.
:)

Abnormal softening of a gland is known as

Jane has a sprained ankle, and her doctor gave her a prescription that states: “ibuprofen caps 200 mg tid po.” what does this prescription say, in spelled-out form?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?