subject
Biology, 02.12.2020 19:20 jkenkw4667

Maria is camping when she starts to smell smoke. She turns on her radio and hears that a forest fire is coming her way. How can Maria's organ systems interact to help keep her safe? Include at least 5 organ systems in your response.

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 19:00
Apea plant that is heterozygous for the tall phenotype can produce short offspring when self pollinating. which of the following explains why this occurs? a. segregation of allels b. condominance of traits c. polygenic expression of traits d. independent assortment of alleles
Answers: 1
question
Biology, 21.06.2019 19:50
Ablastocyst is a group of cells that forms after a human egg is fertilized. the blastocyst consists of two types of cells. some of these cells will become the placenta. what do the other cells develop into?
Answers: 3
question
Biology, 22.06.2019 01:00
Nucleic acid certain protein cell membranes certain carbohydrates
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Maria is camping when she starts to smell smoke. She turns on her radio and hears that a forest fire...
Questions
question
Geography, 22.02.2021 20:50
question
Mathematics, 22.02.2021 20:50
question
Social Studies, 22.02.2021 20:50
question
Social Studies, 22.02.2021 20:50