subject
Biology, 22.11.2020 05:10 dmoore6859

Colorblindness results from

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 02:00
How is ribosomal rna useful as a molecular clock? a. a large portion of the dna ring is not vital to structure or function, allowing it to accumulate neutral mutations. b. its rate of mutation increases over time as organisms continue to evolve and differentiate from each other. c. a slow mutation rate makes it useful for determining evolutionary relationships between ancient species. d. it is only found in select organisms, making it easier to compare relationships between species that have it.
Answers: 1
question
Biology, 22.06.2019 03:00
Me with these questions image attached
Answers: 2
question
Biology, 22.06.2019 11:00
What factors contribute to the effect an environmental toxin has on the human body?
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Colorblindness results from...
Questions