Biology, 13.11.2020 21:50 arieannaensley0616
Brian is a forensic investigator studying a tool mark on a door jam. He has gone through the steps of collecting the tool mark evidence. Next, he searches for an item that might have made the tool marks. What steps should he take with suspected objects he finds?
Identify and describe the tool.
Compare the tool mark cast and the comparison cast under a microscope.
Photograph the tool.
Make a comparison cast of the tool.
Answers: 2
Biology, 22.06.2019 07:00
Give an example of a trait that is controlled by more than one gene.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:10
Which of the following is likely not involved in this example of ecological succession? a) the rotting remains of plants add to the fertility of the soil. b)the soil becomes so fertile that eel grass is replaced by other plant species. c) the roots from plants stabilize the sediment, keeping it in place. d) the concentration of salt becomes so high that all plant life is destroyed.
Answers: 1
Biology, 22.06.2019 14:00
Scientists are conducting a study on the effectiveness of a new drug on memory loss. they are giving some of the test subjects the new drug to find out if it improves their long-term memory. which are possible limitations of this study? check all that apply. a) test subjects may want to participate in additional experiments. b) test subjects may think they should be paid more. c) test subjects may get bored and want to quit early. d) test subjects may have to travel during the experiment. e) test subjects may have full-time jobs. this is multiple choice. you for the !
Answers: 2
Brian is a forensic investigator studying a tool mark on a door jam. He has gone through the steps o...
Biology, 24.08.2021 14:00
Mathematics, 24.08.2021 14:00
Geography, 24.08.2021 14:00
Social Studies, 24.08.2021 14:00
English, 24.08.2021 14:00
Mathematics, 24.08.2021 14:00
Social Studies, 24.08.2021 14:00
Mathematics, 24.08.2021 14:00
Computers and Technology, 24.08.2021 14:00
Mathematics, 24.08.2021 14:00
Mathematics, 24.08.2021 14:00
Mathematics, 24.08.2021 14:00
Mathematics, 24.08.2021 14:00