Biology, 12.11.2020 06:00 Bladedrose2351

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTA GAAG How many proteins were

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the ent

Answers: 2

Show answers

Another question on Biology

Biology, 22.06.2019 12:30

Describe the relationship between isotonic solutions, equilibrium, and water movement into and out of a cell.

Answers: 1

Answer

Biology, 22.06.2019 16:30

Drag the tiles to the correct boxes to complete the pairs. match wach fossil with the layer where it’ll be present based on these condition

Answers: 3

Answer

Biology, 22.06.2019 18:50

The scientific method is limited to investigating physical phenomena that are which of the following? select all that apply. observable repeatable falsifiable unique measurable

Answers: 1

Answer

Biology, 22.06.2019 20:30

An infection of the pulp and the surrounding tissue in the mouth is called

Answers: 1

Answer

You know the right answer?

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the enti...

Questions

Social Studies, 09.12.2020 01:30

Hydroelectricity. Expalin in detail what the process is for creating energy from water?...

Mathematics, 09.12.2020 01:30

A question on a test asks students to find the speed at which a car travels. The graph shows a proportional relationship between the distance traveled...

Mathematics, 09.12.2020 01:30

Solve the system of linear equations. 3x + 5y = -2 2x - y = 3...

Mathematics, 09.12.2020 01:30

Rachel bought a suit on sale for $465. This price was 38% less than the original price. What was the original price?...

Mathematics, 09.12.2020 01:30

Given m||n, find the value of x. (5x-5) (6x-27)...

History, 09.12.2020 01:30

According to the lesson, what did the American Industrial Revolution give rise to as far as its citzens were concerned? •the middie class •the...

Mathematics, 09.12.2020 01:30

Solve the system of equations -x -y = 6 − x − y =6 and 5x-7y=665x−7y=66 by combining the equations....

History, 09.12.2020 01:30

I need more guy friends lol, hmu...

Mathematics, 09.12.2020 01:30

What is the 100th term in the sequence 15, 22, 29, 36, 43,......

Mathematics, 09.12.2020 01:30

If your good at math please help! :) Y is directly related to X, and Y is 81 when X is 27. The constant of variation is ___ (there...

English, 09.12.2020 01:30

What does the old man in The Tale Heart do when he hears a noise on the eighth night? O a Ob Oc O d he reaches for a gun

English, 09.12.2020 01:30

Fix any punctuation or capitalization errors below. Nega Chin had been doing yoga for four years; therefore, it was no surprise when he won the...

Chemistry, 09.12.2020 01:30

it's objects with greater mass have more gravitational pull why are the largest planetsfarther from the Sun...

Mathematics, 09.12.2020 01:30

Edna learned to sing a total of 16 pieces over the course of 8 weeks of voice lessons. After 10 weeks of voice lessons, how many pieces will Edna be a...

Mathematics, 09.12.2020 01:30

Will mark brainliest! The table below shows the average attendance of school events by the day of the week on which they are heldwhich va...

Biology, 09.12.2020 01:30

WORLD POPULATION GROWTH 20,000 people of Millions 10,000 World 5,000 2,000 Asia Africa 1,...

History, 09.12.2020 01:30

What do many historians believe caused the Bantu migrations? A. Wars B. Disease C. Climate D. Overpopulation...

Mathematics, 09.12.2020 01:30

Solve the question using Triangle Similarity Theorem.

Mathematics, 09.12.2020 01:30

Sino may Alam dito pasagot Naman po please ...

History, 09.12.2020 01:30

What things helped Historians understand Greek culture?...

More questions: Biology Another questions