Biology, 06.11.2020 20:10 sassyluvinherself

A food handler reports to work with obvious yellowing of the eyes and skin. What should the person be checked for?

Answers: 3

Show answers

Answers

Hepatitis A is a viral infection, which affects the liver. The person with obvious yellowing of eye and skin should be checked for Hepatitis A.

Hepatitis A is a viral infection caused by the Hepatovirus A. The virus affects the liver, which may lead to mild to severe illness in the patient. The disease is caused by the consumption of contaminated food and water, personal contact with the infected person, and using used drugs with other persons.

Some of the symptoms of Hepatitis A are:

Yellowing of skin and eye stomach pain diarrheafevercolored stools and dark urine

Therefore, the person should be checked for Hepatitis A as he exhibits the symptoms of the disease.

To know more about Hepatitis A, refer to the following link:

link

Answer from: MZ2017

Hepatitis A

Explanation:

Hepatitis A refers to a liver disease or infection that results in mild to severe illness in humans and it is typically caused by the Hepatitis A Virus (HAV).

Generally, the main cause of Hepatitis A is as a result of the ingestion of food or consumption of water that has been contaminated by the Hepatitis A Virus (HAV) or getting in direct contact with fluids from an infected person.

Some of the symptoms of Hepatitis A are loss of appetite, feverish conditions, itching, nausea, fatigue, diarrhea, dark-colored urine, malaise, abdominal pains, yellowing of white portions of the eyes and skin (jaundice).

Hence, if a food handler reports to work with obvious yellowing of the eyes and skin. The sickness or illness that the food handler should be checked for as an adult is Hepatitis A.

Answer from: Quest

energy and particles

Answer from: Quest

In fact it is not just nuclear fusion and fission that can transform matter (or mass)into energy. any time energy is produced, some small amount of matter or mass isconverted into energy.

Another question on Biology

Biology, 22.06.2019 01:00

Nucleic acid certain protein cell membranes certain carbohydrates

Answers: 3

Answer

Biology, 22.06.2019 08:30

Which coal field location is related to coal fields in the eastern united states and supports the theory of continental drift? eastern india southern africa western australia northern south america

Answers: 3

Answer

Biology, 22.06.2019 10:00

Speed is the ratio of the distance of an object moves to

Answers: 1

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

A food handler reports to work with obvious yellowing of the eyes and skin. What should the person b...

Questions