![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 18:30
What type of cell is produced after fertilization occurs and the gametes combines ?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 01:30
What macromolecule is produced during translation? a. carbohydrate b. rna c. dna d. protein
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 08:30
Construct at least two possible hypotheses for the student’s experiment.
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What are three stages of interphase?...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 18.09.2019 23:00
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 18.09.2019 23:00
![question](/tpl/images/cats/biologiya.png)
Biology, 18.09.2019 23:00
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 18.09.2019 23:00
![question](/tpl/images/cats/ekonomika.png)
Business, 18.09.2019 23:00
![question](/tpl/images/cats/himiya.png)
Chemistry, 18.09.2019 23:00
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/himiya.png)
Chemistry, 18.09.2019 23:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 18.09.2019 23:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 18.09.2019 23:00