subject
Biology, 29.10.2020 20:20 diemiten

Pls help me I do not get it the last question


Pls help me I do not get it the last question

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 20:20
Ineed a chemical reaction takes place in which erlergy is released. arrange the reaction's characteristics in order from start to finis lower energy of reactants higher energy of products higher energy of reactants transition state sd lower energy of products
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:30
How energy move through ecosystem ?
Answers: 2
question
Biology, 22.06.2019 14:40
Dna replication occurs in preparation for
Answers: 1
You know the right answer?
Pls help me I do not get it the last question
...
Questions
question
Social Studies, 24.09.2021 20:00
question
Biology, 24.09.2021 20:00
question
Mathematics, 24.09.2021 20:00
question
Chemistry, 24.09.2021 20:10
question
Social Studies, 24.09.2021 20:10