Biology, 29.10.2020 07:50 izzyisnotfizzy
Some dogs bark when trailing; others are silent. The barking trait is due to a dominant gene. Erect ears are dominant to drooping ears. What kinds of pups (their phenotype and genotype) would you expect from a heterozygous erect-eared barker mated to a droop-eared, silent trailer? So both the probable genotype and phenotype of the pups.
Answers: 2
Biology, 22.06.2019 02:30
Plz ! having a smooth seeds is the dominant trait. having wrinkled seeds is a recessive trait. the offspring of two plants with smooth seeds, a. must have smooth seeds. b. may have smooth or wrinkled seeds. c. must have wrinkled seeds. d. have a 25% change of having smooth seeds.
Answers: 1
Biology, 22.06.2019 08:20
10111213141516lactic acid fermentation differs from ethyl alcohol fermentation in thato in ethyl alcohol fermentation co2 is also producedlactic acid fermentation can occur in all living thingsethyl alcohol fermentation can only occur in plantsonly lactic acid fermentation can produce more atp
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 15:00
When fossil fuels are burned, carbon dioxide is released. how does this gas impact the environment?
Answers: 1
Some dogs bark when trailing; others are silent. The barking trait is due to a dominant gene. Erect...
English, 12.04.2021 22:00
Mathematics, 12.04.2021 22:00
Mathematics, 12.04.2021 22:00
Mathematics, 12.04.2021 22:00
Mathematics, 12.04.2021 22:00
Computers and Technology, 12.04.2021 22:00
Mathematics, 12.04.2021 22:00
Mathematics, 12.04.2021 22:00
Computers and Technology, 12.04.2021 22:00
Mathematics, 12.04.2021 22:00
Mathematics, 12.04.2021 22:00
Mathematics, 12.04.2021 22:00