PLEASE HELP IM ON A TIMED TEST!! If thymine makes up 30% of a DNA sample what is the percentage of Adenine?

What is the percentage of Adenine in this DNA sample?

A. 15%
B. 60%
C. 30%

The images show the wings of a bat and a bee. from this evidence, what can you conclude about the evolutionary relationship between these organisms? a. the wing structures of the bat and the bee are different, indicating they didn’t inherit wings from a common ancestor. b. the wing structures of the bat and the bee are different, indicating they inherited wings from a common ancestor. c. the functions of bat wings and bee wings are the same, indicating they obtained wings from a common ancestor. d. the functions of bat wings and bee wings are different, indicating they didn’t obtain wings from a common ancestor.

Nucleic acid certain protein cell membranes certain carbohydrates

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?