I NEED HELP
Where fossil fuels get carbon from?
Burning them carbon in the form of?...
Biology, 23.10.2020 17:20 taylorwhitfield6
I NEED HELP
Where fossil fuels get carbon from?
Burning them carbon in the form of?
Answers: 3
Biology, 22.06.2019 01:50
It is believed that europa, one of jupiter’s moons has an ocean beneath its surface. based on how earth’s oceans and atmosphere are believed to have formed, what can be said about europa’s supposed ocean? the arrival of in the early days of europa’s existence could have formed its ocean. it is likely that the water experienced , similar to earth. it is also possible that this water is retained beneath europa’s surface and in its atmosphere due to europa’s .
Answers: 1
Biology, 22.06.2019 04:00
What amino acid is coded for by this sequence after the mutation
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
English, 01.07.2021 16:20
Mathematics, 01.07.2021 16:20
Mathematics, 01.07.2021 16:20
Mathematics, 01.07.2021 16:30
Mathematics, 01.07.2021 16:30
History, 01.07.2021 16:30
Computers and Technology, 01.07.2021 16:30
Mathematics, 01.07.2021 16:30
History, 01.07.2021 16:30
Mathematics, 01.07.2021 16:30
Chemistry, 01.07.2021 16:30
Law, 01.07.2021 16:30
Geography, 01.07.2021 16:30
Social Studies, 01.07.2021 16:30