The restriction onzyme EcoR1 recognizes the sequence: CATTO OTTAAG And outs the DNA botwoon the and the A on both strands. How many restriction sites are there in the following sequence? ATTOTTOMTTCOTATTGAATTCCO TACACTTAGCATAATTAAGGG
1)none
2)one
3)not enough information
4)three
5)two.

Amale bird-of-paradise uses a dance to attract mates in which it flaps its tail feathers on the ground and jumps around a potential female mate. a different male bird-of-paradise does a similar dance but it jumps around the female in the opposite direction. the female bird is only attracted to one style of dance, in one direction.

_is a product of the first stage of photosynthesis.atpglucosecarbon dioxidewater

The many stone tools, fragmentary animal bones, and teeth found at gran dolina, spain, indicate that hominids there? a. processed and consumed animals and other hominids. b. did not differ appreciably from earlier asian homo erectus. c. were similar to later homo sapiens. d. none of the above