subject
Biology, 22.10.2020 05:01 MickeyAppleX

Place the terms into the correct column that describes the reactions of photosynthesis.


Place the terms into the correct column that describes the reactions of photosynthesis.

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 03:00
To answer this question, researchers studied populations of the dusky salamander (desmognathus ochrophaeus) living on different mountain ranges in the southern appalachian mountains. the researchers tested the reproductive isolation of pairs of salamander populations by leaving one male and one female together and later checking the females for the presence of sperm. four mating combinations were tested for each pair of populations (a and b)—two within the same population (female a with male a and female b with male b) and two between populations (female a with male b and female b with male a). the proportion of successful matings for each mating combination was measured. for example, when all the matings of a particular combination were successful, the researchers gave it a value of 1; when none of the matings were successful, they gave it a value of 0. then the researchers calculated an index of reproductive isolation that ranged from 0 (no isolation) to 2 (full isolation). the reproductive isolation value for two populations is the sum of the proportion of successful matings of each type within populations (aa + bb) minus the sum of the proportion of successful matings of each type between populations (ab + ba). the table provides data for the geographic distances and reproductive isolation values for 27 pairs of dusky salamander populations.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 13:30
What does it mean for an allele to be dominant?
Answers: 1
question
Biology, 22.06.2019 17:00
What are ways that ordinary people can to keep antibiotic resistance from getting worse?
Answers: 1
You know the right answer?
Place the terms into the correct column that describes the reactions of photosynthesis.
...
Questions
question
Mathematics, 18.12.2020 14:00
question
Mathematics, 18.12.2020 14:00
question
Arts, 18.12.2020 14:00
question
Mathematics, 18.12.2020 14:00
question
Social Studies, 18.12.2020 14:00
question
Mathematics, 18.12.2020 14:00