Answer now for branliest. i need within 5 min A star has right ascension of 5 hours. Which of these statements is correct about the star?

It is 5 hours to the west of zero hours right ascension.
It is 5 hours to the east of zero hours right ascension.
It is 5 hours north of the celestial equator.
It is 5 hours south of the celestial equator.

Babies with very low or very high weight are less likely to survive .

The construction of phylogenetic trees is a mapping out the proposed divisions and common ancestors of all living species. traditionally, these trees have been built using morphological data, such as appearance and embryology. recently, it has been possible to construct these trees using molecular data. phylogenetic trees based on different types of information agree with each: that there is strong evidence of a real underlying common descent. this phylogenic tree is composed based on molecular data (rrna). what statements can we infer are true about the organisms throughout the tree? because the tree is rooted, all branches share a common ancestor. all organisms have some sort of cellular structure/organization. all eukaryotes evolved from bacteria. since the organisms contain rna, they share the same dna. if the organisms contain rna, the share the same four nitrogen bases.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?