subject
Biology, 20.10.2020 01:01 andrewbigbrains8740

What means land masses explain with a map for understanding plz i need it

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 01:00
Nucleic acid certain protein cell membranes certain carbohydrates
Answers: 3
question
Biology, 22.06.2019 09:40
Which statement is the best summary of the model? a-a series of aerobic and anaerobic reactions take place in cells b- the sun's energy moves through trophic levels in a food chain c-light energy is converted into stored chemical energy plants.d- food molecules are broken down in the cells if living things.
Answers: 1
question
Biology, 22.06.2019 11:30
If a human has 23 pairs of chromosomes in every muscle cell of its body how many chromosomes will be in a human egg or sperm
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What means land masses explain with a map for understanding plz i need it...
Questions
question
English, 10.10.2019 22:50
question
Mathematics, 10.10.2019 22:50