subject

Biology, 19.10.2020 08:01 dflorez3064

MAY give brainliest! Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC

Highlighted letters are: ATACTACC

ansver

Answers: 2

Show answers

Another question on Biology

question

Biology, 21.06.2019 20:00

Chlorophyll is found in plant leaves and absorbs light from the sun to enable plants to perform photosynthesis. magnesium is an important component of chlorophyll. the concentration of magnesium ions is higher in the root-hair cells of plants than in the soil. which mechanism of ion uptake would best enable a plant to produce a steady supply of chlorophyll? osmosis diffusion passive transport active transport

Answers: 1

question

Biology, 21.06.2019 21:00

Epinephrine is a hormone released from the adrenal gland of the body, most often in a stressful situation. it is known as the "fight-or-flight" hormone. one way that it causes a response in the body is to activate receptors on muscle cells. where are these cellular receptors located? a. on the cell membrane b. in the nucleus c. on the cell wall d. around the mitochondria

Answers: 1

question

Biology, 22.06.2019 07:30

In the respiration-photosynthesis cycle shown above, what are the products of cellular respiration that belong in box 2?

Answers: 3

question

Biology, 22.06.2019 07:50

What is a limitation of using a chemical formula, such as c6h1206, to represent a compound? the chemical formula does not show the types of elements that make up the compound. the chemical formula does not show how the atoms are connected to one another the chemical formula does not show the number of atoms of each element in a molecule. the chemical formula does not show the chemical symbols of the elements in the compound

Answers: 1

You know the right answer?

*MAY* give brainliest! Please give answer and explain:

This sequence encodes for a part...

Questions

question

Mathematics, 17.12.2019 05:31

Auniversity wants to compare out-of-state applicants' mean sat math scores (μ1) to in-state applicants' mean sat math scores (μ2). the university look...

question

Physics, 17.12.2019 05:31

How does the jet stream affect the movement of air masses...

question

Business, 17.12.2019 05:31

1. record the april 1, 2019, balance of each account in the appropriate balance column of a four-column account, type balance in the item section, and...

question

Business, 17.12.2019 05:31

You estimate that a passive portfolio, that is, one invested in a risky portfolio that mimics the s& p 500 stock index, yields an expected rate of...

question

Biology, 17.12.2019 05:31

The covering of fatty material that speeds up the passage of nerve impulses...

question

Business, 17.12.2019 05:31

4. boeing just signed a contract to sell a boeing 737 aircraft to air france. air france will be billed €20 million which is payable in one year. the...

question

Business, 17.12.2019 05:31

During year 1, sparky construction company has a contract to construct a $4,500,000 high-rise apartment building at an estimated cost of $4,000,000. t...

question

Computers and Technology, 17.12.2019 05:31

The market for social-networking website services is characterized by network externalities because: choose one: a. the less other people are...

question

Engineering, 17.12.2019 05:31

Consider a two-stage cascade refrigeration system operating between the pressure limits of 1.4 mpa and 160 kpa with refrigerant-134a as the working fl...

question

Business, 17.12.2019 05:31

Disaggregate traditional dupont roeselected balance sheet and income statement information for oracle corporation follows. (perform the required compu...

question

Business, 17.12.2019 05:31

The following information describes production activities of mercer manufacturing for the year. actual direct materials used 24,000 lbs. at $4.45 per...

question

Business, 17.12.2019 05:31

Excerpts from dowling company's december 31, 2018 and 2017, financial statements and key ratios are presented below (all numbers are in millions): 201...

question

Business, 17.12.2019 05:31

On march 1, 2020, first national bank agrees to lend $85,000 to jt engineering if jt signs an $85,000, 5.5%, four-month note. if jt prepares financial...

question

English, 17.12.2019 05:31

The story of moses offers us another opportunity to analyze how god calls each of us to fulfill a certain part of his plan. god chose moses to lead th...

question

Business, 17.12.2019 05:31

Tangerine inc. is evaluating a capital project for investment. the initial cash outflow in year 0 is $1,500 followed by cash inflow of $500 each year...

question

Business, 17.12.2019 05:31

Carla met her manager to discuss an issue she was facing in the office. during the meeting, her manager's phone was constantly ringing. this made it d...

question

Business, 17.12.2019 05:31

Laredo corporation is considering new equipment. the equipment can be purchased from an overseas supplier for $3,120. the freight and installation cos...

question

Business, 17.12.2019 05:31

All of the following are normal characteristics of a convertible bond, except group of answer choices conversion at the option of the issuer. conversi...

question

Physics, 17.12.2019 05:31

Of the following systems, which contains the most heat? a. 100 kg of water at 80°c b. 250 kg of water at 40°c c....

question

Chemistry, 17.12.2019 05:31

Hydrogen is prepared commercially by the reaction of methane and water vapor at elevated temperatures. ch₄ + h₂ ⇌ 3h₂ + what is the equilibrium const...

More questions: Biology Another questions