*MAY* give brainliest!
Please give answer and explain:
This sequence encodes for a par...
Biology, 19.10.2020 08:01 kyandrewilliams1
*MAY* give brainliest!
Please give answer and explain:
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.
ATTTGCATACTACCGGGC
The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.
Group of answer choices
ATTTGCAATACTACCGGGC
ATGAATGCATACTACCGGGC
ATTTGCATACTGACCGGGC
ATTTGCAACTACCGGGC
ATTAGCATACTACGGGC
Answers: 1
Biology, 21.06.2019 19:00
Imagine that a mouse has white fur because of a mutation in its dna. which of the following conclusions can be drawn
Answers: 1
Biology, 22.06.2019 03:30
Bethβs hygrometer is reading a temperature of 30 c and a relative humidity of 65%. the humidity in the air is?
Answers: 2
Biology, 22.06.2019 07:00
What molecules will be best used to compare different species with the exact same sequence of amino acids? why would two species have the same protein even if the molecules in question is different? (hint: transcription to translation to protein).
Answers: 1
Mathematics, 31.12.2020 21:00
Mathematics, 31.12.2020 21:00
Medicine, 31.12.2020 21:00
Mathematics, 31.12.2020 21:00
Mathematics, 31.12.2020 21:00
Mathematics, 31.12.2020 21:00
Mathematics, 31.12.2020 21:00
Business, 31.12.2020 21:00
Mathematics, 31.12.2020 21:00