Biology, 25.08.2019 07:00 okokalyssa
How does carrying capacity affect the size of population
Answers: 1
Biology, 21.06.2019 17:20
The trp operon in e.coli regulates genes that code for enzymes required for synthesis of the repressible operon. when tryptophan is not available amino acid tryptophan. the trp operon is a in the environment, the trp repressor protein activeinactiveregulated. therefore, rna polymerase can bind to the genes to begin transcription.
Answers: 1
Biology, 22.06.2019 05:50
Is there any species that went extinct in recent years due to natural causes (not caused by human interaction). if so, what caused it?
Answers: 1
Biology, 22.06.2019 09:50
The frequency of alleles in a population that is in hardy weinberg equilibrium? a . changes in each successive generation b. is less important than the frequency genotypes c. shows evidence of the process of natural selection d. remains the same over several generations
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
How does carrying capacity affect the size of population...
Mathematics, 25.09.2021 14:20
Mathematics, 25.09.2021 14:20
Mathematics, 25.09.2021 14:20
Mathematics, 25.09.2021 14:20
Business, 25.09.2021 14:20
English, 25.09.2021 14:20
Mathematics, 25.09.2021 14:20
Mathematics, 25.09.2021 14:20
Mathematics, 25.09.2021 14:30
Engineering, 25.09.2021 14:30
Mathematics, 25.09.2021 14:30