![subject](/tpl/images/cats/biologiya.png)
Biology, 12.10.2020 20:01 joelpimentel
Select the correct answer from each drop-down menu.
During DNA replication, the _ strand is synthesized in the 5′ to 3′ direction. The strand that runs away from the replication fork is synthesized _ because _.
Answers: In the photo below
I hope this helps.
![ansver](/tpl/images/cats/User.png)
Answers: 3
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 10:00
Veins have a much lower blood pressure than arteries. which of these prevents backflow of blood in veins? a. pressure applied by the heart b. one–way valves in veins c. thin muscular walls of veins
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
You know the right answer?
Select the correct answer from each drop-down menu.
During DNA replication, the _ strand is synthes...
Questions
![question](/tpl/images/cats/pravo.png)
Law, 17.02.2020 02:12
![question](/tpl/images/cats/mat.png)
Mathematics, 17.02.2020 02:12
![question](/tpl/images/cats/mat.png)
Mathematics, 17.02.2020 02:12
![question](/tpl/images/cats/istoriya.png)
History, 17.02.2020 02:12
![question](/tpl/images/cats/es.png)
Spanish, 17.02.2020 02:12
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 17.02.2020 02:13
![question](/tpl/images/cats/mat.png)
Mathematics, 17.02.2020 02:13
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 17.02.2020 02:13
![question](/tpl/images/cats/mat.png)
Mathematics, 17.02.2020 02:14
![question](/tpl/images/cats/istoriya.png)
History, 17.02.2020 02:14
![question](/tpl/images/cats/mat.png)
Mathematics, 17.02.2020 02:15
![question](/tpl/images/cats/istoriya.png)
History, 17.02.2020 02:15
![question](/tpl/images/cats/mat.png)
Mathematics, 17.02.2020 02:15
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 17.02.2020 02:15
![question](/tpl/images/cats/mat.png)
Mathematics, 17.02.2020 02:15