![subject](/tpl/images/cats/biologiya.png)
Biology, 30.09.2020 06:01 johhnyappleseed2006
What are the three components that make up an Agricultural Education program
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 11:00
Why did adult crab numbers decline in he ecosystem, even though sea stars were still available?
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 22:10
Red blood cells are responsible for transporting oxygen in the blood. people with sickle cell anemia were born with a defective gene that results in sickle-shaped red blood cells. individuals with the disease often suffer pain in their extremities due to the build-up of these cells causing blockages in the blood vessels. the shape of the blood cells also reduces the amount of oxygen transported in the blood.
Answers: 1
You know the right answer?
What are the three components that make up an Agricultural Education program...
Questions
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 31.03.2021 06:10
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 31.03.2021 06:10
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
English, 31.03.2021 06:10
![question](/tpl/images/cats/mat.png)
Mathematics, 31.03.2021 06:10
![question](/tpl/images/cats/biologiya.png)
Biology, 31.03.2021 06:10
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 31.03.2021 06:10
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 31.03.2021 06:10
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
English, 31.03.2021 06:10
![question](/tpl/images/cats/mat.png)
Mathematics, 31.03.2021 06:10
![question](/tpl/images/cats/biologiya.png)
Biology, 31.03.2021 06:10
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/himiya.png)