![subject](/tpl/images/cats/biologiya.png)
The role of the circulatory system is to do which of the following? (Select all that apply.) Transport O2 and nutrients throughout the body Remove waste products found within the body Move blood to the lungs from the left side of the heart Move blood systemically from the right side of the heart Release of oxygen through the gastrointestinal tract via the splanchnic circulation
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 23:00
If the frequency of the p allele is .63 in the population then what is the frequency of the q allele?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 14:10
What do we call the process when two dominant alleles are expressed and do not blend? a.incomplete dominance b.codominance c.multiple alleles
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 14:20
As scientists have investigated evolution from a variety of fields, they have found that some of darwin's orginal ideas were inaccurate or incomplete. t explanation provided by evolution was updated each time to reflect the new information they found. what does this suggest about the theory of evolution? it has become a stronger and clearer theory as new information is collected.
Answers: 1
You know the right answer?
The role of the circulatory system is to do which of the following? (Select all that apply.) Transpo...
Questions
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 06.10.2019 22:10
![question](/tpl/images/cats/mat.png)
Mathematics, 06.10.2019 22:10
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/en.png)
English, 06.10.2019 22:10
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 06.10.2019 22:10
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 06.10.2019 22:10
![question](/tpl/images/cats/en.png)
English, 06.10.2019 22:10
![question](/tpl/images/cats/fizika.png)
Physics, 06.10.2019 22:10
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
English, 06.10.2019 22:10
![question](/tpl/images/cats/mat.png)
Mathematics, 06.10.2019 22:10
![question](/tpl/images/cats/istoriya.png)
History, 06.10.2019 22:10
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
English, 06.10.2019 22:10
![question](/tpl/images/cats/istoriya.png)
History, 06.10.2019 22:10