Answers: 3
Biology, 22.06.2019 05:30
How is transcription similar to translation in terms of base pairing?
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 23.06.2019 00:10
What do well call it when two or more genes determine an organisms trait? a.polygenic b.controlled by one gene c.mutated
Answers: 2
Biology, 23.06.2019 01:00
What two atoms form a covalent bond a.a sodium and chlorine atom b. an iron and oxygen atom c. two oxygen atoms d. two sodium atoms apex
Answers: 3
Where is most glucose absorbed into the blood...
Mathematics, 16.11.2020 18:00
Mathematics, 16.11.2020 18:00
Computers and Technology, 16.11.2020 18:00
Spanish, 16.11.2020 18:00
English, 16.11.2020 18:00
Mathematics, 16.11.2020 18:00
English, 16.11.2020 18:00
Biology, 16.11.2020 18:00
Biology, 16.11.2020 18:00
Computers and Technology, 16.11.2020 18:00
Mathematics, 16.11.2020 18:00