The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is read from left to right.

AUUUAACUGUUCUGUCUAGAG

1. Use the genetic code to translate the sequence into each of the three possible sets of amino acids.

2. Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.

Disinfection of impression materials is usually accomplished by a. sterilization with high heat. b. spray or immersion in a chemical disinfectant. c. sterilization with steam under pressure. d. allowing the impression to sit 24 hours in water until all the organisms die.

According to the loco mass the mass of reactants and products

Zoe decided to measure the hand length of each of her classmates. first she marked a line across each student's wrist and lined up a ruler from this mark to the top of the middle finger to measure the length. then she recorded the measurements in the table below. marla did this the same way for each classmate, and then zoe used this ruler to measure each straight line and record the data below. this data is invalid. what is the most likely reason why it is invalid? the ruler is marked in centimeters, but zoe recorded data in inches. the range of lengths is too wide, so zoe must have misread the ruler. marla’s complicated measuring procedure was overly confusing. marla could have been inconsistent while drawing outlines of fingers.