Biology, 05.05.2020 13:06 candaceblanton

Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below. AUGCCACAGGUUCAUCCGAA… To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?

Answers: 1

Show answers

Another question on Biology

Biology, 21.06.2019 17:20

In what way are cities microclimates?

Answers: 1

Answer

Biology, 21.06.2019 22:00

This is one of the five kingdoms in the older biological succession. organisms in this kingdom are prokaryotic

Answers: 2

Answer

Biology, 22.06.2019 05:30

What enzyme is most important for dna replication and why?

Answers: 3

Answer

Biology, 22.06.2019 05:30

Which statement describe events that occur during interphase?

Answers: 2

Answer

You know the right answer?

Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a...

Questions

Mathematics, 29.07.2019 20:00

Two ships leave the same port in different directions, forming a 120° angle between them. one ship travels 70 mi. and the other 52 mi. before they eac...

Biology, 29.07.2019 20:00

Which of the organelles in the animal cell is involved in the disposal of cellular waste that is not transported out of the cell? a. mitochondria b....

Mathematics, 29.07.2019 20:00

Ascatter plot is shown. data points are located at 1 and 9, 3 and 5, 5 and 6, 4 and 4, 2 and 7, and 6 and 4. a line of best fit crosses the y-axis at...

Health, 29.07.2019 20:00

Nina attends many seminars. she wants to improve her listening skills. what advice will you give her?...

English, 29.07.2019 20:00

It is the same! —for, be it joy or sorrow, the path of its departure still is free: man’s yesterday may ne’er be like his morrow; nought may endu...

English, 29.07.2019 20:00

What can you infer about lomov at the beginning of the story...

Geography, 29.07.2019 20:00

How does earth tilt contribute to regional climates...

English, 29.07.2019 20:00

When you've carefully checked all the facts and your attitudes and still find that there's "just something" about your supervisor that's causing a pro...

Geography, 29.07.2019 20:00

The sahara divides the continent of africa into north and south sub-saharan africa. true or false?...

Mathematics, 29.07.2019 20:00

Tanisha works 10,000 feet from her home. she bikes to work at a steady rate of 500 feet per minute. use that information and the diagram to complete t...

Geography, 29.07.2019 20:00

Scientists use seismic waves to locate the epicenter. true or false...

History, 29.07.2019 20:00

After world war ii, why did the soviet union take over a number of countries to its west...

English, 29.07.2019 20:00

Write a well-formed paragraph that summarizes the central ideas from the excerpt of emerson’s essay society and solitude. your paragraph should...

Mathematics, 29.07.2019 20:00

Which system is equivalent to 3x squared - 4y squared = 25 over -6x squared -2y squared = 11...

English, 29.07.2019 20:00

Which line most directly states the speaker's feelings in “a song vii” by rabindranath tagore? a) “she has no pride of dress and decoration.” b) “th...

Mathematics, 29.07.2019 20:00

Answer fast i need answer ! to estimate 103% of 63, rich rounded 103% down to 100%, 63 down to 60, and multiplied 60 by 1 to get 60. which of these s...

History, 29.07.2019 20:00

Answer quickly ill give how much interest is earned for the investment? $20,000 for 2 years at 5% compounded annually...

Mathematics, 29.07.2019 20:00

Fast how can jamie rewrite the expression 1/1-sin(theta) so that the fraction has cos^2(theta) in the denominator? she can multiply the numerator and...

English, 29.07.2019 20:00

Question 4 (6.66 points) question 4 unsaved lava rock is used in building roads, and question 4 options: pumice, a glass that comes from lava, is us...

Physics, 29.07.2019 20:00

Which statement describes how echolocation and ultrasound imaging are the same? a. they both use the absorption of sound waves. b. they both use the...

More questions: Biology Another questions