subject
Biology, 29.01.2020 17:02 rosy2019

The genotype of f1 individuals in a tetrahybrid cross is aabbccdd. assuming independent assortment of these four genes, what are the probabilities that f2 offspring would have the following genotypes? show your work.
(1)aabbccdd.
(2) aabbccdd.
(3) aabbccdd.
(4) aabbccdd

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 22:00
Im is in a crowd of people at the mall looking for his girlfriend tammy, who was supposed to meet him for dinner. jim realizes tammy is across the room as he catches a whiff of her overpowering perfume, 'paris #6'. which process explains why jim is able to smell the perfume?
Answers: 2
question
Biology, 22.06.2019 04:00
Which law represents a balanced chemical equation?
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 15:00
Pls me i need this ! each cell has genes activated depending on it's job and what kind of cell it is. it is the presence of that causes the repressor protein to fall off and unblock the gene on the lac operon. if a gene is turned on then it is being an additional circular chromosome found in some bacteria that is used in genetic engineering.
Answers: 2
You know the right answer?
The genotype of f1 individuals in a tetrahybrid cross is aabbccdd. assuming independent assortment o...
Questions
question
Mathematics, 21.04.2021 01:40
question
Chemistry, 21.04.2021 01:40
question
Mathematics, 21.04.2021 01:40
question
Mathematics, 21.04.2021 01:40
question
Mathematics, 21.04.2021 01:40
question
Social Studies, 21.04.2021 01:40