subject
Biology, 23.04.2020 23:12 ari313

What isthe difference between hermatypic and ahermatypic corals

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 02:10
Scenario #2 in 2001, a population of 2,500 poison dart frogs lived in the amazon rain forest. due to increased deforestation, the population dwindled to 25 frogs in 2019. new government regulations were enacted in 2022, successfully putting an end to the deforestation of the amazon rain forest. once deforestation was stopped, the poison dart frog population was able to recover. by 2050, the population reached 8,000 frogs, of that population, 20 are homozygous recessive for being spotted (ss genotype). q2- ? q- p- p2- 2pq-
Answers: 2
question
Biology, 22.06.2019 04:00
Select the true statements about eubacteria. most live as decomposers and heterotrophs. most only thrive in a narrow range of environments. certain eubacteria are responsible for food poisoning. eubacteria thrive in extreme environments.
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:20
First idea: suddenly, women were leaving their homes to cycle and socialize on country roads and city streets. —wheels of change, sue macy second idea: it was not a stretch for some cyclists to see the possibility of a larger role for women in the world. —wheels of change, sue macy what type of graphic organizer would best represent the connection between these two ideas? 1) a t-chart that separates ideas into two different categories 2) a chronology that shows 3) a sequence of several events a cause-and-effect graphic that shows how one idea led to another 4)a problem-solution graphic that presents a problem and a solution to the problem
Answers: 2
You know the right answer?
What isthe difference between hermatypic and ahermatypic corals...
Questions
question
Mathematics, 13.01.2021 22:00
question
Mathematics, 13.01.2021 22:00
question
Mathematics, 13.01.2021 22:00
question
English, 13.01.2021 22:10