subject
Biology, 21.04.2020 20:22 kaffolter25

NEED HELPPP 50 POINTS! WILL MARK BRAINLEIST!!

In this activity, you will build a model of a food web in a specific aquatic ecosystem. You will then use the model to explain what can happen to the competition in the ecosystem if environmental factors change because of natural factors and human interference.

Total time: 2 to 3 hours

You will need these materials:

paper
a pen or a pencil
word-processing or graphic-design software
Part A
Begin by selecting a freshwater or marine aquatic ecosystem as a model for your food web. Be specific. Choose a specific lake. Or, if you choose an ocean ecosystem, identify its geographical area and depth. Keep in mind that deep-sea organisms live in a completely different environment than surface aquatic organisms.

Next, conduct research on the following conditions in the ecosystem you chose. They influence the types of organisms that can live there.

geographical features
temperature
depth/light availability
salinity
pH
unique features that contribute to the ecosystem, such as other bodies of water that connect to it, unusual chemistry, and climate
Using the information you gathered, write a paragraph that describes conditions in the ecosystem.

Part B
Now conduct research on the types of organisms that live in the ecosystem you chose. Note that quaternary consumers and even tertiary consumers can include land animals that rely on the animals in the aquatic ecosystem for food. Collect information based on these guidelines:

Producers: Identify 2-3 species.
Primary (or first-level) consumers: Identify 2-3 species.
Secondary (or second-level) consumers: Identify 2-3 species.
Tertiary (or third-level) consumers: Identify 2-3 species.
Quaternary (or fourth-level) consumers: Identify 1-2 species.
Write down the species you’ve identified for each consumer level in the ecosystem.

Part C
Using the organisms you identified in part B, create a food web for the ecosystem you chose. Use this sample food web for reference, although your food web will contain fewer organisms. Note that your food web does not have to include images, but you may include them if you choose. However, be sure to include arrows to indicate the direction of energy flow in your food web. Design your food web using any method listed below:

Use drawing or flowchart-building tools in a word-processing program.
Hand draw your food web, and then take a picture of it.
Use a graphic-design program.
Using the Insert Image button, insert an image of your food web in the answer space.

Part D
Changes in ecosystems can be attributed to natural causes, such as natural disasters, seasonal variations in climate, currents, and tidal activity. Many of these changes can affect the amount of food resources available in an ecosystem. Research one natural change that currently affects or could affect the aquatic ecosystem you chose. Use your food web model to explain how this change can affect the competition of food resources in your aquatic ecosystem.

Part E
In addition to natural factors, human activity can also alter ecosystems. Conduct research on a human activity that currently affects or can theoretically affect your chosen ecosystem. Use your food web model to explain how this change can affect the competition for food resources.

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 14:20
When is a hurricane considered to have made landfall? a. when at least one inch of rain occurs b. when the eye reaches the land mass c. when the outer wind bands make landfall d. when it moves inland from the coast
Answers: 1
question
Biology, 22.06.2019 01:20
Consider the model of the oxygen cycle on earth. the majority of earth's oxygen reservoirs are found in the a) atmosphere. b) biosphere. c) hydrosphere. d) lithosphere.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:50
Read this summary of a scientific theory: "cells are the most basic structural and functional units of life. all living organisms are made up of one or more cells. all cells that are alive in the world today came from pre-existing cells." which of the following would require this theory to be modified? -a.) a survey finds that a majority of people believe viruses carry out the basic processes of life. -b.) a prominent scientist says she feels strongly that one day the theory will be challenged by life on other planets. -c.) the dna of unicellular and multi-cellular organisms is shown to have many fundamental similarities. -d.) scientific observations show that microscopic organisms living in the deep ocean are not made up of cells.
Answers: 1
You know the right answer?
NEED HELPPP 50 POINTS! WILL MARK BRAINLEIST!!

In this activity, you will build a model o...
Questions
question
Health, 11.11.2020 23:50
question
Chemistry, 11.11.2020 23:50