You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to determine if this sequence might be within the coding region of a gene, you examine it for open reading frames. How many open reading frames exist that go all the way through this DNA fragment? (Recall that the stop codons are 5' TAA, 5' TAG, and 5' TGA.)

Microorganisms aren’t all decomposers; in fact, many act as producers or primary consumers in an ecosystem. how do microorganisms that act as producers benefit the rest of an ecosystem in terms of energy transfer? what about microorganisms that act as primary consumers?

Ageologist determines that a sample of a mineral cant be scratched by a steel nail but can be scratched by a masonry drill bit based on this information the sample mineral has to be softer than

Humans are believed to have evolved in coastal regions in east africa. the region had an abundant supply of fish for early humanoids to eat. when scientists analyze the fads gene they see an interesting pattern. people whose families have lived in this area of east africa for generation show a high level of diversity in alleles for the fads gene. conversely, people whose families had migrated inland a moderate distance from sources of fish showed a much lower diversity for fads gene alleles. additionally, the fads alleles found in people whose family has lived inland for generation are almost all gene alleles which produce fads proteins with a high level of function and activity. how do anthropologists explain this?