How is a warm front different from a cold front?
A. Warm fronts cause snow flurries in t...
How is a warm front different from a cold front?
A. Warm fronts cause snow flurries in the winter, while cold fronts cause several days of rainy weather.
B. Warm fronts cause rapid changes in weather, while cold fronts cause several days of cloudy weather.
C. Warm fronts cause several days of cloudy weather, while cold fronts cause heavy snow in the winter.
D. Warm fronts cause thunderstorms in the summer, while cold fronts cause rain when the air is humid.
Answers: 3
Biology, 22.06.2019 01:00
The allele for curly hair is incompletely dominant. if a mother is homozygous for curly hair and the father is homozygous for straight hair, what percentage of the offspring will exhibit characteristics of both parents? 25 percent 50 percent 75 percent 100 percent
Answers: 2
Biology, 22.06.2019 03:30
In 1992, hurricane andrew left a wake of destruction through florida. one victim of the storm was a reptile-breeding facility. over 900 burmese pythons were set free, and today thousands of pythons live in florida. these pythons are an invasive species, or a harmful species not native to the region. 1. what impacts do you think the burmese pythons might have on local ecosystems
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Chemistry, 25.01.2021 22:20
Arts, 25.01.2021 22:20
Mathematics, 25.01.2021 22:20
Computers and Technology, 25.01.2021 22:20
Computers and Technology, 25.01.2021 22:20
Mathematics, 25.01.2021 22:20
History, 25.01.2021 22:20
Mathematics, 25.01.2021 22:20
Mathematics, 25.01.2021 22:20
Mathematics, 25.01.2021 22:20