PLEASE HELP (WORTH 50 POINTS)

The middle of an mRNA molecule contains the nucleotide
sequence shown here. Much more of the mRNA is translated.
Assume that the sequence is translated from left to right.
AUUUAACUGUUCUGUCUAGAG
Construct an Explanation Based only on the information provided, why could the mRNA
section be translated into three different sets of amino acids, instead of just one set?

picture a world where computers are building made-to-order personalized robotic arms and synthetic organs, drones are circulating above mars! due to the rapid growth of technology, the future has never been more unpredictable, and it presents a huge challenge in education: we are teaching students how to work in a future that we have never been unsure of. it is widely predicted that in eight years’ time, there will be more jobs in the fields of science, mathematics, technology and engineering than in any other discipline. and, as the technology continues to develop, it will soon become clear that addressing social problems will involve more innovative thinking, and analytical and technical knowledge than ever before. undeniably, there are no subjects that encourage innovative and creative thinking, deep thought, problem solving and independence more than the stem subjects. while it is widely commented on that there is a need to reimagine the ways stem subjects are taught in schools by embracing a more interactive and innovative approach to appeal to more students, it should come as no surprise that some of the most reputable educational organizations in the world are already implementing changes to embrace stem. harvard, for example, announced in 2014 that they were increasing their computer science faculty by over 50% and has since introduced computer science as a core subject for all freshmen. the urgency of supporting stem subjects at a young age is becoming more relevant than ever, as adopting a keen interest in the curricula needs to happen early. however, beyond the age issue is one of gender.

let me know if you need more

the sun creates it's own light, also gives light and life to bunch of stuff like plants,animals,humans etc.photosyntesis is the process of making food which needs sun,water,nutrients etc.