subject
Biology, 14.04.2020 23:02 LanaParrilla

A three-point testcross is used to determine the order of three linked genes. The following crossover progeny result: single crossovers, double crossovers, and no crossovers. To determine the order, the no-crossover progeny must be compared to what other class of progeny?

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 21:30
Now it's your turn to investigate human impact around the world. grab your virtual lab coat and put on your environmental science hat. you will be taking a trip around the globe to explore three locations. at each location, you will investigate the cause and effect relationships of deforestation, desertification, and urbanization. you will also gather evidence of how these factors have impacted the environment over time
Answers: 1
question
Biology, 22.06.2019 01:10
Greenthe fossil record is the history of life recorded byhuman observationgod.climatologists.remains of the past.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:30
If a checkpoint detects damaged dna, the checkpoint may
Answers: 1
You know the right answer?
A three-point testcross is used to determine the order of three linked genes. The following crossove...
Questions
question
Spanish, 27.01.2020 23:31
question
Mathematics, 27.01.2020 23:31