How might genetic drift be important in a small population?
1. It increases genetic diversity...
How might genetic drift be important in a small population?
1. It increases genetic diversity by introducing alleles from one population into another.
2. It decreases genetic diversity only by reducing population size.
3. It decreases genetic diversity via sampling error during mating.
4. It increases genetic diversity by introducing new genes into the DNA of a species.
Answers: 3
Biology, 21.06.2019 14:30
What food can provide the body with a quick source of the energy needed to carry out cell functions (a) whole grain bread (b) ground hamburger (c) vegetable oil (d) whole milk
Answers: 1
Biology, 22.06.2019 01:40
An 88 year-old widow with uterine prolapse and multiple comorbid conditions has been unsuccessful in the use of a pessary for treatment elects to receive colpocleisis (lefort type) to prevent further prolapse and avoid more significant surgery like hysterectomy. the treatment is successful. what are the cpt® and icd-10-cm codes reported for this procedure?
Answers: 2
Biology, 22.06.2019 09:20
Give examples of selective advantage of organism’s body part/organ
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Chemistry, 10.12.2020 23:40
Mathematics, 10.12.2020 23:40
Mathematics, 10.12.2020 23:40
Mathematics, 10.12.2020 23:40
History, 10.12.2020 23:40
English, 10.12.2020 23:40
History, 10.12.2020 23:40
Mathematics, 10.12.2020 23:40
Arts, 10.12.2020 23:40