subject
Biology, 08.04.2020 06:41 Jolenesopalski

A student scraped his knee while playing tennis. He noticed that after two weeks his wound had nearly healed with just a small scar remaining
Which statement best explains the healing process?
a
The cells released material that covered the wound and repaired the cells.
The cells near the wound grew in size to cover the injured part.
The cells from distant areas moved in to cover the injured part.
The cells near the wound divided to form new cells.

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 06:50
What is true of sea slugs in these orders
Answers: 1
question
Biology, 22.06.2019 11:30
Which of the following explains why a tree is often used as a model to represent the principle of common descent
Answers: 1
question
Biology, 22.06.2019 11:30
According to theories of how life began, how did early organic molecules begin to separate from the outside world? a: specialized enzymes were required b: chains of amino acids created a barrier c: formation of microspheres or vesicles d: rna catalyzed the formation of membranes
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
A student scraped his knee while playing tennis. He noticed that after two weeks his wound had nearl...
Questions
question
English, 21.08.2019 08:00